-
eDNA metabarcoding data of a long-distance Southern Ocean transect - RV...
These data accompany the paper 'Long-distance Southern Ocean environmental DNA (eDNA) transect provides insights into spatial marine biota and invasion pathways for non-native... -
Prokaryote 16S rRNA sequence data from antFOCE biofilms
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from 16S rRNA gene sequencing of prokaryotes sampled from Biofilm slides... -
Abatus Microsatellites data set
The present data set corresponds to the genotypes for seven microsatellite markers for three Antarctic sea urchin species of the genus Abatus. Sea urchin individuals were... -
DNA diet data collected from Adélie penguin and snow petrel scats at...
Adélie penguin and snow petrel scats were collected at Béchervaise Island (67°35’S, 62°49’E) in the austral summers 2014/2015, 2017/2018 and 2019/2020 and stored in 80% Ethanol.... -
RNA sequence data from krill CO2 exposure experiment
We use RNA sequencing to investigate which genetic/physiological pathways in Antarctic krill are affected by increased CO2 levels. We carried out larval CO2 exposure experiments... -
Southern Ocean eDNA metabarcoding raw sequencing data, collected on the...
On the return leg of the V1 2019 resupply voyage from Davis station to Hobart on the RSV Aurora Australis paired, open ocean environmental DNA (eDNA) samples were taken at 29... -
Antarctic Krill Gonad mRNA Transcriptome
RNA was extracted from pooled gonad tissues and tails of five sexually mature males and females, respectively, originating from the krill aquarium at the AAD in Tasmania,... -
Withdrawn metadata record for Antarctic Krill Gonad mRNA Transcriptome
This metadata record was created in error and a DOI assigned to it before the error was noticed. The correct metadata record is available here:... -
Environmental DNA metabarcoding for monitoring metazoan biodiversity in...
Our aim was to compare water and sediment as sources of environmental DNA (eDNA) to better characterise Antarctic benthic communities and further develop practical approaches... -
V4 2018 eDNA, genetic CPR and large-volume eDNA raw sequencing data
In this data set we examined whether eDNA samples can detect similar numbers of species and community compositions as genetic continuous plankton recorder (CPR) samples. On the... -
Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of...
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Characterising the microbial interactions that drive organic sulphur cycling...
These data come from a set of experiments conducted on the coastal waters near Davis Station in January 2017. The first set of data are from a transect near the Sorsdal glacier... -
The development of DNA markers to resolve uncertainties of seabird bycatch...
Please refer to the manuscript - The development of DNA markers to resolve uncertainties of seabird bycatch identification from longline fisheries in Australian waters.... -
K-Axis mesopelagic fish DNA-based diet analysis
High-throughput DNA-sequencing data for mesopelagic fish stomach contents sampled during the Kerguelen Axis voyage (January-Februay 2016). Mesopelagic fish form an important... -
Kelp rafts in the Southern Ocean: intercontinental travel for sessile and...
Metadata record for data from ASAC Project 2914 See the link below for public details on this project. Can animals raft between countries on floating seaweed? We aim to answer... -
Population genetics dataset for Antarctic krill (Euphausia superba):...
This restriction site associated DNA sequencing (RAD-seq) dataset for Antarctic krill (Euphausia superba) includes raw sequence data and summaries for 148 krill from 5 Southern... -
Genetic identification of fish caught as bycatch in the Antarctic krill...
1st Experiment 24/11/16 See 2016_11_24_Miseq_Sheet 1. Sanger Sequencing Plate #4 - 25mg of Tissue was extracted by AGRF. DNA was diluted to 5ng/ul. Samples were sanger sequenced... -
Winter diet of Gentoo penguins in South Georgia
See spreadsheets - Gentoo Experiment Details 18s Each number corresponds to each worksheet 1. Samples and Date Gentoo penguin scats were collected from Cumberland Bay, South... -
Resilience of Antarctic marine benthic invertebrates and the ecological...
Overview The aim of the project was to assess the genetic connectivity of benthic amphipods (crustaceans) on a circumantarctic scale. Two sibling amphipod species were chosen as...