-
V4 2018 eDNA, genetic CPR and large-volume eDNA raw sequencing data
In this data set we examined whether eDNA samples can detect similar numbers of species and community compositions as genetic continuous plankton recorder (CPR) samples. On the... -
Log and report of observations of seals, penguins, skuas, petrels, and...
This file contains a report and a log of biological observations made in the Davis region during 1962. It includes information on Elephant Seals, Leopard Seals, Crabeater Seals,... -
Fauna survey in the Windmill Islands, 1961-1962
This file contains a report on the fauna of the Windmill Islands, 1961-1962. The file contains information on photographic records, banding data, and nest marking. Species... -
Presence of Disease in the Penguins and Skuas of Macquarie Island
Metadata record for data from ASAC Project 2555 See the link below for public details on this project. This study investigated the role of Antarctic skuas in the transmission of... -
MS Nella Dan Voyage V5 1983/84 (ADBEX2) Track and Underway Data
This dataset contains the underway data collected during the MS Nella Dan Voyage V5 1983/84 (ADBEX2). Voyage name : Antarctic Division BIOMASS Experiment II Voyage leader:... -
Log of skua observations at Casey, 1972-1987
This file contains a log of observations of skuas collected in the Casey region between 1972 and 1987. The hard copy of the log has been archived by the Australian Antarctic... -
Aurora Australis Voyage 1 2009/10 Track and Underway Data
On every voyage of the Aurora Australis, approximately 50 onboard sensors collect data on average every 10 seconds. These data are known as the underway datasets. The type of... -
Aurora Australis Voyage 7 (KROCK) 1992-93 Underway Data
This dataset contains the underway data from Voyage 7 1992-93 (KROCK) of the Aurora Australis. This was a manned marine science voyage. The observations were taken between... -
Voyage 1 2023-24 - RSV Nuyina - Icebreaking Trials - Sea Ice Data
During Voyage 1 of the 2023/24 season, RSV Nuyina undertook a series of ice-breaking trials to quantify the performance of the new ice-breaking vessel. This analysis was... -
Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of...
This metadata record contains an Excel spreadsheet with Operational Taxonomic Units (OTUs) gained from Eukaryotic 18S rDNA PCR amplification and high-throughput sequencing of... -
Assessment of the performance of diffusive gradients in thin-films for metal...
This study assessed the performance of diffusive gradients in thin-films (DGT) with a binding resin that used Chelex-100 (iminodiacetic acid functional groups) to measure... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
Amery Ice Shelf - hot water drill borehole, 2001-02 - AM01 sampling...
AM01 borehole drilled January 2002. Samples collected during drilling and scientific sampling phases of work. AWS continuing to operate. -
High southern latitude cyclone behaviour during the FROST SOPs and its...
Using the ECMWF analyses for the three FROST periods, a data set has been extracted to show the anomalous mean sea level pressure over these periods. In addition a comprehensive... -
Population abundance, trend, structure and distribution of the endangered...
This is a parent record for data collected from AAS project 4102. Project 4102 also follows on from ASAC project 2683, "Passive acoustic monitoring of antarctic marine mammals"... -
Effects of ocean acidification on Antarctic marine microbes - parent record
This metadata record is the parent umbrella under which data from the 2008/09, 2013/14 and 2014/15 summer will be housed. See the child records for access to the data. Manmade... -
CTD Niskin data collected from the BROKE-West voyage of the Aurora Australis, 2006
3 litres of seawater were collected every 2nd CTD (conductivity, temperature and depth) cast on every CTD transect of the BROKE-West voyage. 7 CTD transects were completed on... -
Polar Bird Voyage 5 2002-2003 Underway Data
This dataset contains the underway data collected during the Polar Bird Voyage 5 2002-03. This voyage went to Mawson, Sansom Island and Davis, leaving from and returningto... -
Preferred foraging areas of Heard Island albatrosses during chick raising...
From the abstract of the referenced paper: Incidental mortality in fisheries is causing declines in many albatross populations around the world. To assess potential interactions... -
Long-term passive acoustic recording from Kerguelen deepwater mooring 2005
This dataset contains digitized passive acoustic recordings from a hydrophone connected to an autonomous recording device both moored near the sea-floor in the Southern Ocean....