-
Sensitivity of the Antarctic marine amphipod Orchomenella pinguides to...
Two toxicity tests were conducted in the Davis station laboratories in December 2010. Tests used locally collected amphipods of the species Orchomenella pinguides. The tests... -
Davis Aerodrome Project (DAP) – Marine Current Profiling Data
The Davis Aerodrome Project (DAP) collected a range of environmental survey data over several field seasons to support a comprehensive environmental assessment of the proposed... -
Toxicity tests using the microgastropod, Skenella paludionoides; conducted...
A number of toxicity tests have been conducted using the marine microgastropod, Skenella paludionoides, between the years 2006 and 2010. Tests have determined sensitivity of... -
Comparative Diving Ecology Across Southern Ocean Marine Predators - Seals...
This study was carried out by Giulia Roncon as part of her PhD at IMAS. The study employed both archival and contemporary diving data, collected by six species of marine... -
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,... -
RSV Nuyina Voyage 2 2021-22 Voyage Data, Southern Ocean, Antarctica
This dataset contains the Voyage Data from Voyage 2 2021-22 collected during RSV Nuyina’s maiden voyage to Antarctica. This purpose of this voyage was a combination of... -
Ocean acidification impacts primary and bacterial production in Antarctic...
Three experiments were performed at Davis Station, East Antarctica, 77 degrees 58' E, 68 degrees 35' S to determine the effects of ocean acidification on natural assemblages of... -
Satellite-derived bathymetry - Davis station, Vestfold Hills, 2012
Pre-processed satellite imagery [Davis Station_Preprocessed_WV2_Shallow Water.tif] IMPORTANT: This data cannot be shared due to licensing conditions and is provided for archival... -
Total petroleum hydrocarbons from marine sediments sampled for the Davis STP project
This metadata record contains an Excel file containing total petroleum hydrocarbon data from analysis of marine sediments collected at Davis Station from December 2009 to March... -
International circumpolar compilation of nutrient concentration data from...
This dataset is an international circumpolar compilation of currently available macronutrient concentration data from Antarctic land-fast sea ice cores collected at locations... -
Wave-Ice interactions and ice break-up observations in the Southern Ocean, 2020
This dataset contains ice motion observations made under the Australian Antarctic Program, Projects 4593 and 4506. Measurements of ice motion where made on (land)fast ice on the... -
RSV Nuyina Voyage 5 2021-22 Voyage Data, Southern Ocean, Antarctica
This dataset contains the Voyage Data from voyage 202122050 undertaken by the RSV Nuyina between February 12th and March 27th 2022. The principal objectives of the voyage were... -
Vestfold Hills, Davis station southern elephant seal numbers 1957-2022
The data describe seasonal changes in numbers of southern elephant seals observed on the beach adjacent to Davis station. Count data were collected by various Davis station... -
Molecular data for Davis 14/15 ocean acidification minicosm experiment metadata
Experimental Design A six-level, dose-response ocean acidification experiment was run on a natural microbial community from nearshore Antarctica, between 19th November and 7th... -
Antarctic diatom silicification diminishes under ocean acidification
This data set was collected during an ocean acidification mesocosm experiment performed at Davis Station, Antarctica during the 2014/15 summer season. It includes: - description... -
Phenology based adjustments to population survey data show no temporal...
The Excel spreadsheet titled "1_Cape Petrel Population adjusted Estimates_Table1.xlsx is population survey count data and estimates of Cape petrels in the Vestfold islands, East... -
Davis STP current meter data and effluent dispersal modelling report
This metadata record contains an Excel workbook of current meter data and a report derived from this data detailing an analysis of the mean and variability of the longshore... -
Macromolecular data of diatoms exposed to Ocean Acidification - Mesocosm...
Synchrotron based FTIR macromolecule profiles of 5 diatom species from the AAS_4026 ocean acidification project. Data represent the peak areas for wavenumbers related to key...
1 - 18 of 18 results