Datasets

Explore the central source of Australian open government data. Anyone can access the public data published by federal, state and local government agencies.

Location

Add a specific geographic region using search by title, adding coordinates or drawing a box on a map.

Choose LGA

Or enter coordinates

West bounding longitude

East bounding longitude

South bounding latitude

North bounding latitude

Search data

Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...

CSIRO Oceans & Atmosphere

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,...
Dataset updated: 13/03/2025
- PNG

Datasets

1 dataset found

Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...

Can't find what you're looking for? Suggest a new dataset