From Australian Oceans Data Network

Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

Created 13/03/2025

Updated 13/03/2025

This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).

Files and APIs

Tags

Additional Info

Field Value
Title Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
Language eng
Licence notspecified
Landing Page https://devweb.dga.links.com.au/data/dataset/7d29cbdf-f78c-465e-ba7b-2d828e59f6ec
Contact Point
CSIRO Oceans & Atmosphere
metadata@aad.gov.au
Reference Period 16/11/2019 - 26/11/2019
Geospatial Coverage {"type": "Polygon", "coordinates": [[[77.2145, -68.0036], [147.4927, -68.0036], [147.4927, -43.2379], [77.2145, -43.2379], [77.2145, -68.0036]]]}
Data Portal data.gov.au

Data Source

This dataset was originally found on data.gov.au "Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples". Please visit the source to access the original metadata of the dataset:
https://devweb.dga.links.com.au/data/dataset/raw-sequencing-data-of-a-euphausiid-specific-metabarcoding-marker-to-detect-krill-species-of-th

No duplicate datasets found.