From Australian Oceans Data Network
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
Created 13/03/2025
Updated 13/03/2025
Files and APIs
Tags
Additional Info
Field | Value |
---|---|
Title | Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples |
Language | eng |
Licence | notspecified |
Landing Page | https://devweb.dga.links.com.au/data/dataset/7d29cbdf-f78c-465e-ba7b-2d828e59f6ec |
Contact Point | |
Reference Period | 16/11/2019 - 26/11/2019 |
Geospatial Coverage | {"type": "Polygon", "coordinates": [[[77.2145, -68.0036], [147.4927, -68.0036], [147.4927, -43.2379], [77.2145, -43.2379], [77.2145, -68.0036]]]} |
Data Portal | data.gov.au |
Data Source
This dataset was originally found on
data.gov.au
"Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples". Please visit the source to access the original metadata of the dataset:
https://devweb.dga.links.com.au/data/dataset/raw-sequencing-data-of-a-euphausiid-specific-metabarcoding-marker-to-detect-krill-species-of-th
-
Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect...
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG,...
No duplicate datasets found.